| Ribosome in action - 113 sec
Nanotechnology at work
Auteur : EffortlessActions
Tags:cell dna molecular machine nano-device nanotechnology protein ribosome
 |
| Traduction sur ribosome - 60 sec
traduction de l'arn en protéine grace au ribosome dans le noyau d'une cellule eucaryote
Auteur : AzureNenwen
Tags:ribosome traduction arn noyau
|
| Metabolic Melodies - "The Ribosome" - 47 sec
Oregon State University students singing Kevin Ahern's Metabolic Melody, "The Ribosome" to the tune of "America the Beautiful." Lyrics available at http://www.davincipress.com/metabmelodies.html
CDs available at http://www.lulu.com/content/1307905
Auteur : oharow
Tags: biochemistry metabolic melody kevin ahern ribosome protein synthesis mRNA tRNA rRNA America the Beautiful
|
| The Ribosome: An Infomercial - 320 sec
I edited this video for a Human Biology project.
Auteur : JediJoker7169
Tags:biology human bio school project infomercial commercial day group 6 period 7 six seven random stereotype stereotypical
|
| Ribosome Bop - 128 sec
My band Ambiguous Toad covers The Ramones "Blitzkrieg Bop" with our own twist. This was done for a school project, and it was for fun, and somewhat comedic on the vocals ;)
Auteur : highroller540
Tags: The Ramones Ambiguous Toad Alternative Rock Indie cool seymour duncan sh-4 JB Gretsch Catalina
|
| Ribosome and RNA - 434 sec
Ribosome goes on a quest to find his RAN, and gets stuck outside of the cell. OH NOES!
Auteur : Stumpnuggets
Tags: RNA ribosome NUAMES nuames n.u.a.m.e.s. Chase Travis Stump Gabbitas Hillarious bus funny laugh best worst greatest
|
| Belly Dancing Ribosome - 27 sec
This is a Normal Mode Simulation of a ribosome (30 S part is removed) together with a transfer RNA. From the work of Jernigan & Bahar: "Global Ribosome Motions Revealed with Elastic Network Model" Wang, Y. Rader, AJ, Bahar, I. & Jernigan, RL. , J. Struct Biol 147: 302-314, 2004. Soundtrack: İkimiz bir fidanız-Hakkı Bulut
Auteur : eirekarmatech
Tags:Belly Dancing Ivet Bahar Burak Erman Rob Jernigan Ozlem Keskin ANM GNM Hakkı Bulut
|
| ribosome by sharkattack - 81 sec
ribosome by sharkattack
Auteur : myspace408sanjo
Tags: ribosome by sharkattack
|
| Finding the Ribosome - 32 sec
Scientific Model
Auteur : wdgram
Tags:Agris Ribosome Model
|
| Hey There Ribosome - 146 sec
Music video for our 10th grade biology class.
Auteur : 37over53
Tags: hey there delilah ache productions funny music video ribosome
|
| Ribosome Campaign Outtakes - 53 sec
The ribosome campaign advertisement had some issues.
Auteur : escumolove
Tags: ribosome outtake
|
| Club Ribosome - 580 sec
Epic mobster thriller filmed in 2004. Can mRNA get the code for an enzyme to tRNA before the Lactose Boys get away?
Auteur : LordoftheRing434
Tags:club ribosome
|
| Ribosome Campaign - 25 sec
The Ribosome Campaign takes it to the next level.
Auteur : girlchamp491
Tags: Ribosome campaign
|
| Juju ribosome - 19 sec
Quand Juju imite Sophie DW
Auteur : sophie2908
Tags:Juju ribosome
|
| ribosome project...... - 293 sec
.......
Auteur : derej24
Tags:OneTrueMedia project ribosome
|
| Dancing Ribosome - 17 sec
This is a Normal Mode Simulation of a ribosome (30 S part is removed) together with a transfer RNA. From the work of Jernigan & Bahar: "Global Ribosome Motions Revealed with Elastic Network Model" Wang, Y. Rader, AJ, Bahar, I. & Jernigan, RL. , J. Struct Biol 147: 302-314, 2004
Auteur : eirekarmatech
Tags:Protein Simulation NMA
|
| Ribosomes - 29 sec
ribosomes ribosomes ribosomes ribosomes... a video about a lonely ribosome. ribosome ribosome ribosome- what about the smoothe endoplasmic reticulum? or the nucleic acid? or even the cell wall?
Auteur : chikinpotato11
Tags:ribosome ribosomes video multiplies to solve his problems short film
|
| Molecular Dynamics Flexible Fitting - 98 sec
Ribosome (in blue, gold) makes cell proteins from amino acids delivered by tRNAs (orange, green, purple) and EF-Tu (red), and is a popular target for antibiotics research. A method for capturing ribosome in action is shown; the method reveals movement of a protein (blue, curly) into the ribosome.
Visit here for more information:
http://www.ks.uiuc.edu/Research/mdff/
Auteur : tcbguiuc
Tags: ribosome molecular dynamics antibiotics
|
| From RNA to Protein Synthesis - 170 sec
RNA is synthesized from DNA, and enters the ribosome where protein translation and synthesis occurs.
Auteur : michaelfreudiger
Tags:DNA RNA protein synthesis ribosome nucleotide codon
|
| Protein Synthesis Claymation - 26 sec
I know the animation and photo quality aren't all that great, but it took a while. I made it with JPEG video, a stop motion animation program and I edited it in Windows Movie Maker. It is 15 frames per second and 341 pictures.
This video shows transcription of DNA to RNA and translation of RNA to a polypeptide. Here is a slightly more detailed explanation of what is happening because a few things had to be cut:
The DNA polymerase (not shown in movie) unzips the DNA. Then the RNA forms, by matching each guanine (G) of the DNA to RNA's cytosine (C) and vice versa; and matching each thymine (T) to adenine (A); and each A to uracil (U). In the movie, T is red, C is brown, G is blue, A is yellow, and U is green. The movie doesn't show this, but the RNA is made by matching each nucleotide one at a time, instead of coming in fully formed as the movie depicts. The enzyme called RNA polymerase is what catalyzes this process, but that also isn't shown in the movie.
The DNA goes back together in helix form and the mRNA (messenger RNA, which was just made) moves to the ribosome, an organelle. The ribosome is made up of protein and RNA called rRNA (ribosomal RNA). This is where translation begins. Only two codons (a section of RNA with three nucleotides) can fit in the ribosome at a time. The tRNA (transfer RNA), which are the brown crosses with nucleotides, come into the ribosome. The nucleotides on the bottom of the tRNA, called anti-codons, match the codons of the mRNA. Each tRNA is attached to a specific amino acid, which are the colored balls in the video. The type of amino acid is based on the codon on the mRNA that the tRNA matches. The codons in this video code for Valine, Aspartate, Threonine, Histidine, Tyrosine, and Phenylalanine. The last codon doesn't have a matching tRNA because it is a stop codon which signals for the translation process to stop. These amino acids bond through dehydration synthesis as the process continues to form a polypeptide, thus making protein.
DNA code used in video that was transcribed: CAACTGTGTGTAATAAAGATC
RNA code that was transcribed from above DNA and then translated: GUUGACACACAUUAUUUCUAG
Auteur : JesterOfKings
Tags: biology protein synthesis claymation stop motion stopmotion dna rna polypeptide science
|
